Skip to main content

Table 1 Primers used for real-time PCR

From: Exaggerated effects of particulate matter air pollution in genetic type II diabetes mellitus

Primer Forward oligonucleotides Reverse oligonucleotides
UCP1 ACTGCCACACCTCCAGTCATT CTTTGCCTCACTCAGGATTGG
PGC1 α GAGAATGAGGCAAACTTGCTAGCG TGCATGGTTCTGAGTGCTAAGACC
PRDM16 CAGCACGGTGAAGCCATTC GCGTGCATCCGCTTGTG
Cidea ATCACAACTGGCCTGGTTACG TACTACCCGGTGTCCATTTCT
Elovl3 GATGGTTCTGGGCACCATCTT CGTTGTTGTGTGGCATCCTT
CPT1M TGCCTTTACATCGTCTCCAA GGCTCCAGGGTTCAGAAAGT
F4/80 TGTCTGACAATTGGGATCTGCCCT TTGCATGTTCAGGGCAAACGTCTC
INFɣ GCTCTGAGACAATGAACGCT AAAGAGATAATCTGGCTCTGC
IL-4 TCGGCATTTTGAACGAGGTC GAAAAGCCCGAAAGAGTCTC
TNF α TTCCGAATTCACTGGAGCCTCGAA TGCACCTCAGGGAAGAATCTGGAA
IL-6 ATCCAGTTGCCTTCTTGGGACTGA TAAGCCTCCGACTTGTGAAGTGGT
β-actin TGTGATGGTGGGAATGGGTCAGAA TGTGGTGCCAGATCTTCTCCATGT