Skip to main content

Table 3 Real time PCR primer pairs

From: RETRACTED ARTICLE: Mechanisms of nanosized titanium dioxide-induced testicular oxidative stress and apoptosis in male mice

Gene name Description Primer sequence Primer size (bp)
Refer- GAPDH mactin-F 5′- TGTGTCCGTCGTGGATCTGA −3′  
mactin-R 5′- TTGCTGTTGAAGTCGCAGGAG −3′ 150
SOD mSOD F 5′-CTGGACAAACCTGAGCCCTAA-3′  
mSOD R 5′-TCCCCAGCAGCGGAATAA-3′ 242
CAT mCATF 5′-AGCGACCAGATGAAGCAGTG-3′  
mCAT R 5′-GGGTGACCTCAAAGTATCCAAA-3′ 241
GSH-Px mGSH-Px F 5′-GGGACTACACCGAGATGAACG-3′  
mGSH-Px R 5′-TCCGCAGGAAGGTAAAGAGC-3′ 231
GST mGST F 5′-CCGCTCTTTGGGGCTTTAT-3′  
mGST R 5′-GGTTCTGGGACAGCAGGGT-3′ 191
GR mGR F 5′- TTCTGTTCATGGCGTGAGTACC −3′  
mGR R 5′- CCCTTGGCACCTATTCCAGTT −3′ 150
Cyp1b1 mCyp1b1-F 5′-TTAGTATGCTTTTCGCTGTGACA -3′  
mCyp1b1-R 5′-GGGGAGTTATTCCTGGGTTATTA-3′ 81
Car3 mcar3 F 5′-GCTCTGCTAAGACCATCC-3′  
mcar3 R 5′-ATTGGCGAAGTCGGTAGG-3′ 160 bp
Caspase-3 mcaspase-3 F 5′-CTGACTGGAAAGCCGAAACTC-3′  
mcaspase-3 R 5′-GACTGGATGAACCACGACCC-3′ 203
Bcl-2 mbcl-2 F 5′-TGTGGTCCATCTGACCCTCC-3′  
mbcl-2 R 5′-ACATCTCCCTGTTGACGCTCT-3′ 224
Nrbp2 mnrbp2 F 5′-TGCAGTGCAACCTGGAAA-3′  
mnrbp2 R 5′-AGGAAACCAGGGTGGCTC-3′ 188
Acaa2 macaa2 F 5′-TGTGTCAGAAATGTGCGCTTC-3′  
macaa2 R 5′-CAAGGCGTATCTGTCACAGTC-3′ 123
Axud1 mAxud1-F 5′-CGCCCTTCATTAGCTGATGTT -3′  
mAxud1-R 5′-CAGAGCCTGCGTTTCTTGG-3′ 117
Cytochrome c mcytochrome c F 5′-CATCCCTTGACATCGTGCTT-3′  
mcytochrome c R 5′-GGGTAGTCTGAGTAGCGTCGTG-3′ 250
  1. PCR primers used in the gene expression analysis