Skip to main content

Table 2 Primer sets used in this study

From: Nanoparticle exposure reactivates latent herpesvirus and restores a signature of acute infection

Gene name Forward primer (5’–3’) Reverse primer (5’–3’)
Acta2 GTCCCAGACATCAGGGAGTAA TCGGATACTTCAGCGTCAGGA
Actb TCCATCATGAAGTGTGACGT GAGCAATGATCTTGATCTTCAT
Bex2 TCCAAAGTGGAACAAGGCGT GCACGTAGTAGTCTCCAGCTTC
Fn3k TGGCCCCGTGTTTGTCAAG CTGGCAAGTCAATCACCTTCAT
Ltbp4 CTGGGTGTCGCTATTGGTG GTTGTGACAGATCAAGGGACAT
Tab1 CTTTCGCAACTGGGTTTAGACG CGCCATGAATTTCCGGCTC
MHV-68 ORF50 CCCACGGTTCGCTATACAGTAAAGAC ATTGTGTAGAGGGTCCAGGTTAATGATTTC
MHV-68 ORF73 TGGTGGAGGAGGGGCTGGTC ACCGACTACACGCAACACAACC
Pvalb ATCAAGAAGGCGATAGGAGCC GGCCAGAAGCGTCTTTGTT
Rrm1 CTGGCAGCAAGGATAGCCG CCGTTGTGCGGATTTATGTAGT
Sirt1 ATGACGCTGTGGCAGATTGTT CCGCAAGGCGAGCATAGAT
Spp1 AGCAAGAAACTCTTCCAAGCAA GTGAGATTCGTCAGATTCATCCG
Sprr1a TTGTGCCCCCAAAACCAAG GGCTCTGGTGCCTTAGGTTG
Tlk1 AGTCAGGGAAAAAGTATCGGGG TTCTGCGGAGAACGGATTGC
EBV EBNA1 CCAAGAAGGTGGCCCAGA CCTGCCTCCATCACCCTG
EBV BZLF1 TTCCACAGCCTGCACCAGTG GGCAGCAGCCACCTCACGGT
humanFn3k CATCCCGCAGGTGAATGAGTG GGGGACAATCTCTAGGCCAC
humanHPRT GCAGACTTTGCTTTCCTTGGTCAG GTCTGGCTTATATCCAACACTTCGTG
humanTab1 TGAGGAACTTTGGCTACCCG GTCGGGCTTTGGTTGGTGA
humanRrm1 CATGTGATCAAGCGAGATGGC GTGACCCCACTGTACAAGCC
humanSirt1 TGGGTACCGAGATAACCTTCT TGTTCGAGGATCTGTGCCAA
humanTlk1 CCATCTTGGTCCCAGCTCTCC CGTTATTTGTTGAGGCTTTAGCTCC