Skip to main content

Advertisement

Table 5 Summary of the primer sequences that were used for qRT-PCR experiments with the endothelial cells of the tetraculture

From: Endothelial responses of the alveolar barrier in vitro in a dose-controlled exposure to diesel exhaust particulate matter

Gene Primer F Primer R Reference
HMOX1 TTCTCCGATGGGTCCTTACACT GGCATAAAGCCCTACAGCAACT [44]
CASP7 CGGTCCTCGTTTGTACCGTC GGTGGTCTTGATGGATCGCA [44]
SOD1 GTGCAGGTCCTCACTTTAAT CTTTGTCAGCAGTCACATTG [44]
FAS AGCTTGGTCTAGAGTGAAAA GAGGCAGAATCATGAGATAT [44]
NF k B GCTTGTAGGAAAGGACTGCC GTTGTTGTTGGTCTGGATGC [71]
CYP1A1 GGAGGCCTTCATCCTGGAGA CCTCCCAGCGGGCAACGGTC [72]
IL-6 GGAGACTTGCCTGGTGAAAA GTTGGGTCAGGGGTGGTTAT  
NEF2 ACATTGAGCAAGTTTGGGAG TGTGGACTACAGTTACCTAC  
NQO1 GGAGAGTTTGCTTACACTTACGC TTCTCCAGGCGTTTCTTCCA  
ICAM-1 GCAAGGTGACCGTGAATGT GCATAAAGCCCTACAGCAAC  
GST1 ACAGTTGTACAAGTTGCAGGATG TGCCAAAGAGATTGTGCTTG  
HSP70 CCTACTCCGACAACCAACCC GGTGATCTTGTTGGCCTTGC  
HMOX2 GGGAAAGGAGACATGCGTAA CAAGAGTCCAGCAGCTAGGG  
E-Selectin ACCTCCACGGAAGCTATGACT CAGACCCACACATTGTTGACTT  
VCAM1 CTTAAAATGCCTGGGAAGATGGT GTCAATGAGACGGAGTCACCAAT  
B2M TGCTGTCTCCATGTTTGATGTATCT TCTCTGCTCCCCACCTCTAAGT [64]
HPRT1 TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT [64]
YWHAZ ACTTTTGGTACATTGTGGCTTCAA CCGCCAGGACAAACCAGTAT [64]
SDHA TGGGAACAAGAGGGCATCTG CCACCACTGCATCAAATTCATG [64]
  1. Unless further mentioned, qRT-PCR primer were designed for the experiments of this study