Skip to main content

Advertisement

Table 1 Sequences information of the gene primers

From: Iron oxide nanoparticles induce reversible endothelial-to-mesenchymal transition in vascular endothelial cells at acutely non-cytotoxic concentrations

  Forward Reverse
HO-1 AAGACTGCGTTCCTGCTCAAC AAAGCCCTACAGCAACTGTCG
GAPDH GTCAAGCTCATTTCCTGGT CCAGGGTTTCTTACTCCTTG