Skip to main content

Table 1 Primers used for real-time PCR

From: Ambient particulate air pollution induces oxidative stress and alterations of mitochondria and gene expression in brown and white adipose tissues

Gene Forward primer (5' - 3') Reverse primer (5' - 3')
Hoxc9 GCAGCAAGCACAAAGAGGAGAAG GCGTCTGGTACTTGGTGTAGGG
Igfbp3 GCAGCCTAAGCACCTACCTC TCCTCCTCGGACTCACTGAT
Dpt CTGCCGCTATAGCAAGAGGT TGGCTTGGGTACTCTGTTGTC
Ucp1 GGCCTCTACGACTCAGTCCA TAAGCCGGCTGAGATCTTGT
Pgc-1α GAAAGGGCCAAACAGAGAGA GTAAATCACACGGCGCTCTT
Dio2 AAGGCTGCCGAATGTCAACGAATG TGCTGGTTCAGACTCACCTTGGAA
Elovl3 GCCTCTCATCCTCTGGTCCT TGCCATAAACTTCCACATCCT
β-actin TGTGATGGTGGGAATGGGTCAGAA TGTGGTGCCAGATCTTCTCCATGT