Skip to main content

Advertisement

Table 5 Sequences of primers used in quantitative RT-PCR

From: Global gene expression changes in human embryonic lung fibroblasts induced by organic extracts from respirable air particles

Symbol RefSeq ID Oligonucleotide
CYP1B1 NM_000104.2 sense CACTGGAAACCGCACCTC
   antisense AGCACCGACAGGAGTAGC
MGST1 NM_145792.1 sense CACCTGAATGACCTTGAAAATATTATT
   antisense TCCGTGCTCCGACAAATAGT
NKD2 NM_033120.2 sense GGAAGGTCACCAGGGAGGA
   antisense TTCACACGGAGGGTCTTGC
BMP2 NM_001200.2 sense GGGCATCCTCTCCACAAAAG
   antisense CCACGTCACTGAAGTCCAC
SMAD3 NM_005902.3 sense GGCTGCTCTCCAATGTCAAC
   antisense ACCTCCCCTCCGATGTAGTA
TBXAS1 NM_001061.2 sense ATCTTCCTCATCGCTGGCTAT
   antisense CCTTAAAAACGTCTACCTCTCCA
CCND2 NM_001759.2 sense TGGGACAATGGGTGGTGAA
   antisense GCAAAGCTGGCTCTTGAGAA
PTGS2 NM_000963.1 sense CAAATCATCAACACTGCCTCAAT
   antisense TCTGGATCTGGAACACTGAATG
TJP1 NM_175610.2 sense AAACAAGCCAGCAGAGACC
   antisense CGCAGACGATGTTCATAGTTTC
WNT2 NM_003391.1 sense CAAGAACGCTGACTGGACAA
   antisense CCCCAGAAAGAACCCAAAGG
ID2 NM_002166.4 sense CGATGAGCCTGCTATACAACA
   antisense AGGTCCAAGATGTAGTCGATGA