Skip to main content

Table 2 Primers used for real-time quantitative PCR

From: Critical role of surface chemical modifications induced by length shortening on multi-walled carbon nanotubes-induced toxicity

Gene Forward primer Reverse primer
RPL-13 GTGGTCCCTGCTGCTCTCCAA CGATAGTGCATCTTGGCCTTTT
HO-1 CACGCATATACCCGCTACCT CCAGAGTGTTCATTCGAGCA
GPX-1 TGAAGAGATTCTGAATTCCCTCAAG CAGGAAGGTAAAGAGCGGGTG
SOD-1 CAAATTACAGGATTAACTGAAGGCC GGCCACCATGTTTCTTAGAGTGAG
TNF-α CTGTCTACTGAACTTCGGGGTGAT GGTCTGGGCCATAGAACTGATG
CXCL2 GAACATCCAGAGCTTGAGTGTGAC CTTGCCTTTGTTCAGTATCTTTTGG
  1. RPL13, ribosomal protein L13; HO-1, heme oxygenase-1; SOD, superoxide dismutase; GPX-1, Glutathione peroxidase-1; CXCL2, macrophage inflammatory protein-2; TNF-α, tumour necrosis factor alpha.