Skip to main content

Advertisement

Table 1 Primer sequences for qPCR analysis

From: No involvement of alveolar macrophages in the initiation of carbon nanoparticle induced acute lung inflammation in mice

Gene MGI ID 5'-primer 3'-primer
Actb MGI:87904 TCCATCATGAAGTGTGACGT GAGCAATGATCTTGATCTTCAT
Hprt MGI:96217 GTTGGATACAGGCCAGACTTTGT CACAGGACTAGAACACCTGC
Cxcl1 MGI:108068 CCGAAGTCATAGCCACAC GTGCCATCAGAGCAGTCT
Cxcl2 MGI:1340094 TCCAGAGCTTGAGTGTGACG TCCAGGTCAGTTAGCCTTGC
Cxcl5 MGI:1096868 CCCTACGGTGGAAGTCAT CTTCACTGGGGTCAGAGT
Nos2 MGI:97361 CCTGTGAGACCTTTGATG CCTATATTGCTGTGGCTC
Tnf MGI:104798 CACCACGCTCTTCTGTCTG GCTACAGGCTTGTCACTC
Il1b MGI:96543 CAACCAACAAGTGATATTCTCCATG GATCCACACTCTCCAGCTGCA
Nfkbia MGI:104741 TACTCCCCCTACCAGCTTAC GACTCCGTGTCATAGCTCTC
Nfkbib MGI:104752 CTGCATCTAGCAGCCATC GGCTCTGAGTGAGGTAGGTA
Nfkbiz MGI:1931595 GCCAGGTCCAGATTAGGT CCTCACCTAGAGAGAGAGCA
Cd68 MGI:88342 CCTCCACCCTCGCCTAGTC TTGGGTATAGGATTCGGATTTGA
Aqp1 MGI:103201 CATCACCTCCTCCCTAGTC GCTGAGCCACCTAAGTCTC