Skip to main content

Table 1 PCR Primers

From: Prenatal and postnatal mothering by diesel exhaust PM2.5-exposed dams differentially program mouse energy metabolism

Gene Name Acronym Function Forward primer Reverse primer
glyceraldehyde-3-phosphate dehydrogenase GAPDH a house-keeping gene encoding enzyme for the oxidative phosphorylation of glyceraldehyde-3-phosphate TGAACGGGAAGCTCACTGG TCCACCACCCTGTTGCTGTA
pro-opiomelanocortin-alpha POMC a polypeptide hormone precursor involved in energy homeostasis GCCCTCCTGCTTCAGACCTC CGTTGCCAGGAAACACGG
neuropeptide Y NPY a neuropeptide that regualtes food intake TACCCCTCCAAGCCGGACAA TTTCATTTCCCATCACCACATG
agouti related neuropeptide AgRP a neuropeptide that regulates feeding behavior CGGAGGTGCTAGATCCACAGA AGGACTCGTGCAGCCTTACAC
interleukine-1beta IL-1b a pro-inflammatory cytokine ACGGACCCCAAAAGATGAAG TTCTCCACAGCCACAATGAG
interleukine-6 IL-6 a pro-inflammatory cytokine ATCCAGTTGCCTTCTTGGGACTGA TAAGCCTCCGACTTGTGAAGTGGT
tumor necrosis factor alpha TNFα a pro-inflammatory cytokine TTCCGAATTCACTGGAGCCTCGAA TGCACCTCAGGGAAGAATCTGGAA
suppressor of cytokine signaling 3 SOCS3 cytokine-inducible negative regulators of cytokine signaling GCGGGCACCTTTCTTATCC TCCCCGACTGGGTCTTGAC
Leptin   an adipokine involved in regulation of body weight GGGTAATACTTAAACAGTGACC CTATCTGAAAATAAAAACTTCATG
Adiponectin   an adipokine involved in regulation of fatty acid catabolism and glucose levels AGGGAGAGAAAGGAGATGCAG CTTTCCTGCCAGGGGTTC
fatty acid synthase FAS the synthesis of palmitate from acetyl-CoA and malonyl-CoA TGCTCCCAGCTGCAGGC GCCCGGTAGCTCTGGGTGTA
peroxisome proliferator activated receptor gamma PPARγ a regulator of adipocyte differentiation. TCGCTGATGCACTGCCTATG GAGAGGTCCACAGAGCTGATT
sterol regulatory element binding transcription factor 1c SREBP-1c a transcription factor that binds to the sterol regulatory element-1 (SRE1), which is involved in sterol biosynthesis GATGTGCGAACTGGACACAG CATAGGGGGCGTCAAACAG
Acetyl-CoA carboxylase ACC A biotin-containing enzyme which catalyzes the rate-limiting step in fatty acid synthesis. GCCGTGGGGAAGGAAAAGT CTCCTGGTTGATGCTCGACA
PPARG coactivator 1 alpha PGCα a transcriptional coactivator involved in energy metabolism. GAGAATGAGGCAAACTTGCTAGCG TGCATGGTTCTGAGTGCTAAGACC
estrogen receptor 1 (alpha) ER a member of the nuclear hormone family of intracellular receptors ACCATTGACAAGAACCGGAG CCTGAAGCACCCATTTCATT
CCAAT/enhancer binding protein alpha CEBP a transcription factor involved in body weight homeostasis. CTGCGGGGTTGTTGATGT ATGCTCGAAACGGAAAAGGT
Preadipocyte factor 1 PREF1 Inhibits Adipogenesis AGTGCGAAACCTGGGTGTC GCCTCCTTGTTGAAAGTGGTCA