Skip to main content

Table 1 Primer and probe sequences for quantitative reverse transcription-polymerase chain reaction analyses

From: Dose-dependent induction of astrocyte activation and reactive astrogliosis in mouse brain following maternal exposure to carbon black nanoparticle

Gene Sequence (5′–3′) Tm (°C)
Gapdh (NM_008084.2) F TGTGCAGTGCCAGCCTCGTC 60
R GGATGCATTGCTGACAATCT  
Sox17 (NM_011441) F AAGTAGCTCCAGAAACTGCAG 60
R CTGCTCATTGTATCCATGAGGTGA  
Tgfa (NM_031199) F CTAGCGCTGGGTATCCTG 60
R CACTCACAGTGTTTGCGGAG  
Nos3 (NM_008713) F CTCTGCCTCACTCATGGGCACG 60
R GGATTTTGTAGCTCTTGTGCTGCTC  
Tbx1 (NM_001285472) F CTACCAGAATCACCGGATCACG 60
R CCGAGAGCGAGCAAAGGC  
P TAAGATTGCCAGCAACCCCTTCGCCAAAG  
Kdr (NM_010612) F TCACCGGAAATCTGGAGAATCAG 60
R CTCAGTACAATGCCTGAATCTTCTAC  
P ACAACCATTGGCGAGACCATTGAAGTGACT  
Flt1 (NM_010228) F TGAGGAGCTTTCACCGAACTC 60
R ACTCGCTATTCTCAAGTCTATCTTCA  
P CTTGGTCTCAGTCCAGGTGAACCGCTTC  
Tie1 (NM_011587) F CCATGCTTTTGTCTACCAAAGTCA 60
R GCGGCATTCCCAGAACCC  
P AGCCAGACAGGACCACAGCAGAGTT  
Cyr61 (NM_010516) F ATCGCAATTGGAAAAGGCAGC 60
R GGCGTGCAGAGGGTTGAAA  
P AGGCTTCCTGTCTTTGGCACCGAACC  
Cxcl12 (NM_021704) F TCGCCAGAGCCAACGTCAA 60
R GATCCACTTTAATTTCGGGTCAATGC  
P CCAAACTGTGCCCTTCAGATTGTTGCACGG