Skip to main content

Table 5 Sequences of qRT-PCR primers

From: Changes of physico-chemical properties of nano-biomaterials by digestion fluids affect the physiological properties of epithelial intestinal cells and barrier models

Gene Forward (5′–3′) Reverse (5′–3′)
TJP1 CCCCACTCTGAAAATGAGGA ACAGCAATGGAGGAAACAGC
OCLN ATGCCATGGGACTGTCAACT TTTGTGGGACAAGGAACACA
CLDN3 CCTGCGTCTGTCCCTTAGAC CACGCGAGAAGAAGTACACG
CLDN5 GCTGTTTCCATAGGCAGAGC CCCTGCCGATGGAGTAAAGA
TNF TGGGATCATTGCCCTGTGAG GGTGTCTGAAGGAGGGGGTA
IL6 GGTACATCCTCGACGGCATCT GTGCCTCTTTGCTGCTTTCAC
IL10 AGACAGACTTGCAAAAGAAGGC TCGAAGCATGTTAGGCAGGTT
IL22 GCTGCCTCCTTCTCTTGG GTGCGGTTGGTGATATAGG
S14 AGGTGCAAGGAGCTGGGTT TCCAGGGGTCTTGGTCCTATTT